Respostas

A melhor resposta!
2014-07-05T18:16:20-03:00
FITA COMPLEMENTAR: DNA!

AGGCTACCGTCAATATAGCATCGAATACGGACG
TCCGATGGCAGTTATATCGTAGCTTATGCCTGC

NÃO TEM URACILA, POIS NÃO FAZ PARTE DA TRANSCRIÇÃO, PROCESSO NO QUAL O DNA REPRODUZ UM RNA!
1 5 1
Adenina <->Timina
Citosina <->Guanina