Uma cadeia de rna foi produzida tendo como molde o filamento de dna esquematizado abaixo CGCATACATGACGCGAGCTAT

pergunta-se
A- qual é a sequencia de base nesse RNA?
B- quantos aminoácidos constituirão a proteína produzida a partir dessa molécula de RNA?

obrigada!

1

Respostas

2013-10-09T00:25:39-03:00

Esta é uma Resposta Verificada

×
As Respostas verificadas contém informações confiáveis, garantidas por um time de especialistas escolhido a dedo. O Brainly tem milhões de respostas de alta qualidade, todas cuidadosamente moderadas pela nossa comunidade de membros, e respostas verificadas são as melhores de todas.
A)
TAC CGA TTA CGG TCG- produzirá o RNAm
AUG GCU AAU GCC AGC- com 5 códons


B)Há pelo menos 20 grupos de radicais diferentes constituindo os aminoácidos


Espero ter ajudado