Respostas

2014-03-25T10:54:18-03:00
O início da síntese de uma proteína se dá quando um determinado trecho de DNA, um gene, tem suas duas cadeias separadas pela ação de uma enzima chamada polimerase do RNA, que também orienta o agrupamento de nucleotídios livres no núcleo, junto a uma dessas cadeias. Esses nucleotídios unem-se, formando, então, uma molécula de RNA.Os nucleotídios agrupam-se segundo um emparelhamento de bases nitrogenadas parecido com aquele das duas cadeias do DNA, com a diferença de que a adenina se emparelha com a uracila (A - U). Dessa forma, se a sequência de bases nitrogenadas do DNA for, por exemplo, TACAATCGCATTCAGGTACTG, a sequência de bases do RNA formado será AUGUUAGCGUAAGUCCAUGAC.